Splicing in action: assessing disease causing sequence changes | Journal of Medical Genetics
Learning the Sequence Determinants of Alternative Splicing from Millions of Random Sequences - ScienceDirect
Origination of the Split Structure of Spliceosomal Genes from Random Genetic Sequences | PLOS ONE
Splice variation| Oxford Nanopore Technologies
Ultra-deep sequencing reveals pre-mRNA splicing as a sequence driven high-fidelity process | PLOS ONE
Non-canonical splice junction processing increases the diversity of RBFOX2 splicing isoforms - ScienceDirect
RNA splicing - Wikipedia
A modified Kohonen network for DNA splice junction classification | Semantic Scholar
Is PRNP mRNA alternatively spliced?
A computational analysis of sequence features involved in recognition of short introns | PNAS
A single m6A modification in U6 snRNA diversifies exon sequence at the 5' splice site | Nature Communications
Splice junction site sequence logos of PtiICS in comparison with... | Download Scientific Diagram
The Exon Junction Complex and intron removal prevents resplicing of mRNA | bioRxiv
Nucleotide sequence at the splice junction sequences and sizes of exons... | Download Table
Recognition of splice-junction genetic sequences using random forest and Bayesian optimization | SpringerLink
Aberrant splicing events caused by insertion of genes of interest into expression vectors
ORFs, Splicing & Coding
RNA Splicing | Learn Science at Scitable
Splice Sites (Molecular Biology)
Frontiers | A Bioinformatics-Based Alternative mRNA Splicing Code that May Explain Some Disease Mutations Is Conserved in Animals
Frontiers | A Bioinformatics-Based Alternative mRNA Splicing Code that May Explain Some Disease Mutations Is Conserved in Animals
Discerning novel splice junctions derived from RNA-seq alignment: a deep learning approach | BMC Genomics | Full Text
Branch Point Identification and Sequence Requirements for Intron Splicing in Plasmodium falciparum | Eukaryotic Cell
Splice site mutation - Wikipedia
GitHub - drusk/splice-junction-gene-sequences: Recognizes, given a sequence of DNA, the boundaries between exons (the parts of the DNA sequence retained after splicing) and introns (the parts of the DNA sequence that are
Discerning novel splice junctions derived from RNA-seq alignment: a deep learning approach | BMC Genomics | Full Text
Branch Point Identification and Sequence Requirements for Intron Splicing in Plasmodium falciparum | Eukaryotic Cell
Solved Sequence 1: 5' TAGGTGAAAGAGTAGCCTAGAATCAGTTA 3' | Chegg.com
